World Library  
Flag as Inappropriate
Email this Article

List of Y-DNA single-nucleotide polymorphisms

 

List of Y-DNA single-nucleotide polymorphisms

Mutation number Nucleotide change Position (base pair) Total size (base pairs) Position Forward 5′→3′ Reverse 5′→3′
M1 (YAP) 291bp insertion
M2 A to G 168 209 aggcactggtcagaatgaag aatggaaaatacagctcccc
M3
M4
M8
M9
M15
M17
M20
M33
M35
M38
M40
M42
M45
M52
M55
M57
M60
M64.1
M75
M89
M91
M94
M95
M96
M105
M122
M124
M130
M131
M132
M139
M145
M168
M170
M172
M173
M174
M175
M176
M179
M201
M203
M207
M213
M214
M216
M217
M231 G to A 110 331 cctattatcctggaaaatgtgg attccgattcctagtcacttgg
M241 G to A 54 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc
M242 C to T 180 366 aactcttgataaaccgtgctg tccaatctcaattcatgcctc
M253 C to T 283 400 gcaacaatgagggtttttttg cagctccacctctatgcagttt
M258
M267 T to G 148 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M268
M269
M285 G to C 70 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M286 G to A 129 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M287 A to T 100 287 ttatcctgagccgttgtccctg tgtagagacacggttgtaccct
M297
M299
M304 A to C 421 527 caaagtgctgggattacagg cttctagcttcatctgcattgt
M306
M335 T to A 162 417 aagaaatgttgaactgaaagttgat aggtgtatctggcatccgtta
M339 T to G 285 517 aggcaggacaactgagagca tgcttgatcctgggaagt
M340 G to C 218 386 ccagtcagcagtacaaaagttg gcatttctttgattatagaagcaa
M342 C to T 52 173 agagagttttctaacagggcg tgggaatcacttttgcaact
M343 C to A 402 424 tttaacctcctccagctctgca acccccacatatctccagg
M347
M349 G to T 209 493 tgggattaaaggtgctcatg caaaattggtaagccattagct
M356
M359 T to C 122 447 cgtctatggccttgaaga tccgaaaatgcagacttt
M365 A to G 246 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M367 A to G 196 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M368 A to C 200 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M369 G to C 45 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M370 C to G 166 274 ccttcatttaggctgtagctgc tgtatctttagttgagatgg
M405

See also

External links

  • Sequence information for 218 M series markers published by 2001
  • ISOGG Y-DNA SNP Index - 2007
  • Karafet et al. (2008) Supplemental Research Data
This article was sourced from Creative Commons Attribution-ShareAlike License; additional terms may apply. World Heritage Encyclopedia content is assembled from numerous content providers, Open Access Publishing, and in compliance with The Fair Access to Science and Technology Research Act (FASTR), Wikimedia Foundation, Inc., Public Library of Science, The Encyclopedia of Life, Open Book Publishers (OBP), PubMed, U.S. National Library of Medicine, National Center for Biotechnology Information, U.S. National Library of Medicine, National Institutes of Health (NIH), U.S. Department of Health & Human Services, and USA.gov, which sources content from all federal, state, local, tribal, and territorial government publication portals (.gov, .mil, .edu). Funding for USA.gov and content contributors is made possible from the U.S. Congress, E-Government Act of 2002.
 
Crowd sourced content that is contributed to World Heritage Encyclopedia is peer reviewed and edited by our editorial staff to ensure quality scholarly research articles.
 
By using this site, you agree to the Terms of Use and Privacy Policy. World Heritage Encyclopedia™ is a registered trademark of the World Public Library Association, a non-profit organization.
 



Copyright © World Library Foundation. All rights reserved. eBooks from Hawaii eBook Library are sponsored by the World Library Foundation,
a 501c(4) Member's Support Non-Profit Organization, and is NOT affiliated with any governmental agency or department.