World Library  
Flag as Inappropriate
Email this Article

Subgenomic mRNA

Article Id: WHEBN0014547609
Reproduction Date:

Title: Subgenomic mRNA  
Author: World Heritage Encyclopedia
Language: English
Subject: RNA, Nidovirales, RNTP, P1-derived artificial chromosome, A-DNA
Collection:
Publisher: World Heritage Encyclopedia
Publication
Date:
 

Subgenomic mRNA

Subgenomic mRNA's are essentially smaller sections of the original transcribed template strand.

3' to 5' DNA or RNA

During transcription, the original template strand is usually read from the 3' to the 5' end from beginning to end. Subgenomic mRNAs are created when transcription begins at the 3' end of the template strand (or 5' of the to-be-newly synthesized template) and begins to copy towards the 5' end of the template strand before "jumping" to the end of the template and copying the last nucleotides of the 5' end of the template, (finishing the 3' tail for the newly created strand).

As a result, the translated strand will have a similar 5' end to varying degrees with the original template (depending on which part of the template the transcription jumped over) and a similar 3' end to the template.[1]

5' to 3' (positive sense) viral RNA

Positive-sense (5' to 3') viral RNA which may be directly translated into the desired viral proteins, undergoes a similar process as described in 3' to 5'. Portions of the viral RNA may be skipped during translation.

Result

The result is that many different proteins can be created from the same mRNA strand, with similar 5' ends (to varying degrees) and same 3' ends. Or, different proteins can be created with positive sense viral RNA.

The 5' section on the newly created strand matches that of the template strand, and this section on the template strand is referred to as the "nested set".[2]

3' 5'

 GCCGCCCCGTATCGATCGTAGCGCACGTTATATATACGTTATTTCTGCGCGGAAAAAAAAA - Original template Strand
 
5'                                                          3'
 GCCGCCCCGTATCGATCGTAGCGCACGTTATATATAC---------------AAAAAAAAA      |
 GCCGCCCCGTATCGATCGTAGCGCAC--------------------------AAAAAAAAA      | = Subgenomic mRNA. - indicates jumps.
 GCCGCCCCGTAT----------------------------------------AAAAAAAAA      |
 
 GCCGCCCCGTAT = Nested Set

Examples

This complex method of transcription is generally restricted to viruses, especially those of the single-stranded, positive-sense RNA or Class IV viruses using the Baltimore Classification System, e.g. viruses of the order Nidovirales.

Its use is primarily used for compacting more genetic information into a shorter amount of genetic material.[3]

Literature

  1. ^ Wu B, White KA. "Uncoupling RNA virus replication from transcription via the polymerase: functional and evolutionary insights." EMBO J. 2007 Nov 22
  2. ^ Le TM, Wong HH, Tay FP, Fang S, Keng CT, Tan YJ, Liu DX. "Expression, post-translational modification and biochemical characterization of proteins encoded by subgenomic mRNA8 of the severe acute respiratory syndrome coronavirus." FEBS J. 2007 Aug;274(16):4211-22. Epub 2007 Jul 20.
  3. ^ Xu W, White KA. "Subgenomic mRNA transcription in an aureusvirus: Down-regulation of transcription and evolution of regulatory RNA elements." Virology. 2007 Nov 5
This article was sourced from Creative Commons Attribution-ShareAlike License; additional terms may apply. World Heritage Encyclopedia content is assembled from numerous content providers, Open Access Publishing, and in compliance with The Fair Access to Science and Technology Research Act (FASTR), Wikimedia Foundation, Inc., Public Library of Science, The Encyclopedia of Life, Open Book Publishers (OBP), PubMed, U.S. National Library of Medicine, National Center for Biotechnology Information, U.S. National Library of Medicine, National Institutes of Health (NIH), U.S. Department of Health & Human Services, and USA.gov, which sources content from all federal, state, local, tribal, and territorial government publication portals (.gov, .mil, .edu). Funding for USA.gov and content contributors is made possible from the U.S. Congress, E-Government Act of 2002.
 
Crowd sourced content that is contributed to World Heritage Encyclopedia is peer reviewed and edited by our editorial staff to ensure quality scholarly research articles.
 
By using this site, you agree to the Terms of Use and Privacy Policy. World Heritage Encyclopedia™ is a registered trademark of the World Public Library Association, a non-profit organization.
 



Copyright © World Library Foundation. All rights reserved. eBooks from Hawaii eBook Library are sponsored by the World Library Foundation,
a 501c(4) Member's Support Non-Profit Organization, and is NOT affiliated with any governmental agency or department.